![]() To install the EDirect software, open a terminal window and execute one of the following two commands: sh -c "$(curl -fsSL )" ![]() This becomes very useful for example if you have a comma separated value document and want to turn it into a tab separated value document.EDirect will run on Unix and Macintosh computers, and under the Cygwin Unix-emulation environment on Windows PCs. GTTTAAATAATGGCATCATCCAGCATGAGCTGCTCCACGCTATGGGTTTCTACCACGAACACACTCGCAGCGACCGTGACĪAATATGTCAAAATCAACTGGGATAACATACAAGAATATTATTATAAAAACTTCAAAAAAATGGACACAGACAATCTCACĬCCATATGACTACTCCTCTGTGATGCAATATGGAAAAACTGCCTTTGGAAAGAACAGGGCAGAATCCATCACTCCTATCC TCTGGCCAAAGTCTTCAAATGGGAATGTGGAAATCCCTTTTGTTTTAAGTGACGAATATGATCACAACGAGAAGAATCAGĪTTCTCAAAGCCATGAAGGGCTTTGAGGGTAGAACCTGCATCCGCTTTGTTCGTCATAGAGGAGAGAGGGCGTACCTGAGĬATTGAGTCCAAATTTGGCTGTTTCTCTTTGATGGGTCGTTCTGGAGAAAGGCAGCTTGTGTCTCTGCAGAGACCCGGTT GATAATTACAAAGCAGATGACGAAAACTCAGAGAAGGAGGACATCACAACCACTATCCTCAGAATGAACAATGGATCTGCĬGATATGCTGTTTGAAGGAGACGTTTTTGTTCCAAGATCCCGGACTGCCAAGAAGTGCCTTGATCCACGTTACAGCTGTT GGAAGGAAAAAATGGATCTCCAAGCACGAGCCTTGCTTCTGCTCCTGCTGCTTTCAGCCGTCTGTAATGCTTACCCCACA Zcat NM.001309911.1 Fundulus heteroclitus low choriolytic enzyme-like (LOC105918466), mRNA P.S.: To quit the man prompt you can just type “q” That way you can experiment with commands and use various options of them. This option is equivalent to defining CLICOLOR in the environment. Tical bar (`|') after each that is a FIFO. ![]() Sign after each symbolic link, an equals sign (`=') after each socket, a percent sign (`%') after each whiteout, and a ver. F Display a slash (`/') immediately after each pathname that is a directory, an asterisk (`*') after each that is executable, an at e Print the Access Control List (ACL) associated with the file, if present, in long (-l) output. d Directories are listed as plain files (not searched recursively). c Use time when file status was last changed for sorting (-t) or long printing (-l). C Force multi-column output this is the default when output is to a terminal. b As -B, but use C escape codes whenever possible. Is the numeric value of the character in octal. B Force printing of non-printable characters (as defined by ctype(3) and current locale settings) in file names as \xxx, where xxx a Include directory entries whose names begin with a dot (.). This is the default when output is not to a terminal. 1 (The numeric digit ``one''.) Force output to be one entry per line. The following options are Display extended attribute keys and sizes in long (-l) output. If more than one operand is given, non-directory operandsĪre displayed first directory and non-directory operands are sorted separately and in lexicographical order. If no operands are given, the contents of the current directory are displayed. That will give you the (man)ual for that command.įor each operand that names a file of a type other than directory, ls displays its name as well as any requested, associated information.įor each operand that names a file of type directory, ls displays the names of files contained within that directory, as well as any In order to find out how to use a command you can always use the command man in front of whichever command you’d like to use. In this case I am using the modifier -lh, to make ls (list) spit out a (l)ist of files/folders that is (h)uman readable in the directory /. rw-r-r- 1 root wheel 313B Aug 17 17:55 installer.failurerequestsĭr-xr-xr-x 2 root wheel 1B Oct 18 12:52 netĭrwxr-xr-x 6 root wheel 192B Oct 1 16:17 63 root wheel 2.0K Oct 1 16:16 1 root wheel 11B Oct 1 16:16 tmp -> 9 root wheel 288B Sep 20 21:01 1 root wheel 11B Oct 1 16:16 var -> private/varĭrwxr-xr-x 3 root wheel 96B Oct 1 16:19 vm Drwxrwxr-x 67 root admin 2.1K Oct 16 14:59 Applicationsĭrwxr-xr-x 64 root wheel 2.0K Oct 1 16:21 Libraryĭrwxr-xr-x 2 root wheel 64B Oct 1 16:17 5 root wheel 160B Sep 20 21:05 Systemĭrwxr-xr-x 6 root admin 192B Oct 1 16:17 Usersĭrwxr-xr-x 3 root wheel 96B Oct 18 14:12 Volumesĭrwxr-xr-x 22 eoziolor staff 704B Aug 31 11:39 37 root wheel 1.2K Sep 20 21:17 binĭrwxrwxr-t 2 root admin 64B Oct 1 16:17 coresĭr-xr-xr-x 3 root wheel 4.2K Oct 15 17:58 1 root wheel 11B Oct 1 16:16 etc -> private/etcĭr-xr-xr-x 2 root wheel 1B Oct 18 12:52 home ![]()
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |